|
BORNA VIRUS, NEW, PROVENTRICULAR DILATION DISEASE: REAGENT OFFER
****************************************************************
A ProMED-mail post
<http://www.promedmail.org>
ProMED-mail is a program of the
International Society for Infectious Diseases
<http://www.isid.org>
Date: Fri 25 Jul 2008
From: Thomas Briese
<thomas.briese@columbia.edu>
Novel Borna virus in Proventricular Dilatation Disease
------------------------------------------------------
Proventricular dilation disease [PDD] is a
typically fatal syndrome of psittacine and other
birds characterized by gastrointestinal
dysfunction and wasting that is associated with
inflammatory cellular infiltrates in the central,
peripheral and autonomic nervous systems. It is
presumed to be infectious; however, no causative
agent has been implicated. Using high throughput
sequencing a virus only distantly related to
Borna disease virus, the sole and prototypic
member of the family _Bornaviridae_, order
_Mononegavirales_, has been identified in brain,
adrenal gland, and gastrointestinal tract of
birds with PDD but not in unaffected birds. Real
time PCR assays are established that enable
sensitive detection of this virus. Although proof
of PDD causation has not been established, the
identification of an infectious agent that may
not be detected with existing diagnostic tests
and may be linked to zoonotic disease merits
distribution of protocols and reagents.
Our Taqman real time PCR assays target the
amino-terminal region corresponding to the viral
phosphoprotein gene. Two isolates have been found
that require different primer/probe sets;
however, cycling conditions are the same. RNA is
reverse transcribed with random hexamers and
amplified in Taqman PCR using cycle conditions:
50 deg C for 2 min, 95 deg C for 10 min, followed
by 45 cycles at 95 deg C for 15 sec and 60 deg C
for 1 min.
PCR primers and probe for samples 1322
and 1034 were 5'CAGACAGCACGTCGAGTGAGA3'(forward),
AGTTAGGGCCTCCCTGGGTAT3'(reverse),
6FAM-AGGTCCCCGCGAAGGAAGCGA-TMR3' (probe);
primers and probes for sample 1367
were 5'AGAAGACCCGCTGACAGCA3' (forward),
5'AAGCTTCTCGACGGGAACAG3' (reverse), and 6FAM-
TCGTGGGGACCTCGATCTCACTCG-TMR (probe).
Surveys of birds to investigate virus sequence variability will likely
enable development of more broadly reactive primer/probe sets. These
sets will be posted promptly as they are validated.
Positive control plasmid DNA is available by request to Kirsi Honkavuori at
<kh2358@columbia.edu>.
--
[Byline:
-- Kirsi Honkavuori, Thomas Briese, Brent
Williams, Phuong-Lan Quan, Craig Street, Gustavo
Palacios and W. Ian Lipkin Columbia University, New York, NY, USA
-- Stephen K. Hutchison and Michael Egholm 454
Life Sciences, Branford, CT, USA
-- H. L. Shivaprasad California Animal Health
and Food Safety Laboratory System-Fresno Branch,
University of California, Davis, CA, USA]
--
Thomas Briese, PhD
Center for Infection and Immunity
Mailman School of Public Health, 18th floor
Columbia University
722 West, 168th Street
New York, NY 10032 USA
<thomas.briese@columbia.edu>
[According to 'Virus Taxonomy" (The Eighth Report
of the International Committee on Virus
Taxonomy), the virus family _Bornaviridae_
comprises a single genus _Borna virus_ containing
a single species _Borna disease virus_ (see:
<http://www.ncbi.nlm.nih.gov/ICTVdb/ICTVdB/01.081.htm>
for a description of the genus). Borna virus has
a wide host range, but its natural reservoir has
not been determined. Despite its wide host range
and phenotypic variation, molecular
epidemiological data have revealed a remarkable
sequence conservation. Uniquely among negative
stranded RNA viruses, replication and
transcription take place in the cell nucleus.
Borna virus is probably distributed worldwide.
Thomas Briese and colleagues, using the powerful technique of high
throughput sequencing, have obtained evidence of a Borna-like agent in
the tissues of birds suffering proventricular dilation disease. They
are inviting others to make use of the reagents they have produced in
search of other Borna-like viruses. ProMED-mail welcomes the
opportunity to promote this research and hopes there will be a good
response to this generous initiative. - Mod.CP
For a 3D Bornavirus image see:
<http://upload.wikimedia.org/wikipedia/de/thumb/c/cd/Bdv_c.jpg/200px-Bdv_c.jpg>
- Mod.JW]
[see also:
2001
----
Borna disease, horses - France 20010105.0043
1999
------
Chronic disease: Borna virus & mental illness 19990113.0045
1998
----
Borna disease virus & schizophrenia: association? 19980825.1689
Borna disease virus, possum - New Zealand (02) 19980403.0610
Borna disease virus, possum - New Zealand: RFI 19980331.0596
1997
----
Borna virus & disease: review 19970610.1227
Borna disease 19970610.1218
Wobbly possum virus isolated (Borna?) - New Zealand 19970607.1190
Borna disease virus, cats 19970404.0707
1996
----
Borna virus in man - Germany 19960724.1319]
....................cp/ejp/jw
*##########################################################*
************************************************************
ProMED-mail makes every effort to verify the reports that
are posted, but the accuracy and completeness of the
information, and of any statements or opinions based
thereon, are not guaranteed. The reader assumes all risks in
using information posted or archived by ProMED-mail. ISID
and its associated service providers shall not be held
responsible for errors or omissions or held liable for any
damages incurred as a result of use or reliance upon posted
or archived material.
************************************************************
Become a ProMED-mail Premium Subscriber at
<http://www.isid.org/ProMEDMail_Premium.shtml>
************************************************************
Visit ProMED-mail's web site at <http://www.promedmail.org>.
Send all items for posting to: promed@promedmail.org
(NOT to an individual moderator). If you do not give your
full name and affiliation, it may not be posted. Send
commands to subscribe/unsubscribe, get archives, help,
etc. to: majordomo@promedmail.org. For assistance from a
human being send mail to: owner-promed@promedmail.org.
############################################################
############################################################
|